fernando camargo (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
fernando camargo
Fernando Camargo, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fernando+camargo/pLARRY-EGFP+(Plasmid+%23140025)/bio_rxiv__64898__2026__02__24__707683-306-21-23
Average 93 stars, based on 15 article reviews
Fernando Camargo, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fernando+camargo/pLARRY-EGFP+(Plasmid+%23140025)/bio_rxiv__64898__2026__02__24__707683-306-21-23
Average 93 stars, based on 15 article reviews
fernando camargo - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Biomarker Discovery:Article Title: Fitness and transcriptional plasticity of human breast cancer single-cell-derived clones. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pair 2 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGGACTCAC TGGCCGTCGTTTT Integrated DNA technologies N/A Pair 3 forward primer: TCGTCGGCAGCGT CAGATGTGTATAAGAGACAGCAACTAGA AGGCACAGGTCG Integrated DNA technologies N/A Pair 3 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGAGACTCA CTGGCCGTCGTTT Integrated DNA technologies N/A Software and algorithms Metacell version 0.3.7 Baran et al.23 https://tanaylab.github.io/metacell/ Seurat version 5.1.0 Satija et al.27 https://satijalab.org/seurat/ Custom code This paper https://github.com/cclab-brca/ clone-dynamics RStudio version 2023.12.0 + 369 Posit Software, PBC https://posit.co/download/ rstudio-desktop/ FastQC version 0.11.9 Andrews, S.38 N/A Cutadapt version 1.10 Martin, M.39 N/A edgeR version 3.32.1 Chen et al.40 N/A UCell version 2.2 Andreatta and Carmona.41 N/A Pathfinder version 2.3.0.9000 Ulgen et al.42 N/A Mclust version 6.1.1 Scrucca et al.22 N/A DescTools version 0.99.57 Signorell, A.43 N/A lmerTest version 3.1–3 Kuznetsova et al.44 N/A 10x Genomics Cell Ranger version 7.0.1 Zheng et al.45 https://www.10xgenomics.com/ Clustree version 0.5.1 Zappia and Oshlack46 https://github.com/lazappi/clustree scDblFinder version 1.18.0 Germain et al.47 https://github.com/plger/scDblFinder dittoSeq version 1.16.0 Bunis et al.48 https://github.com/dtm2451/dittoSeq 16 Cell Reports 44, 115699, May 27, 2025 .. Barcode library construction and diversity validation Three barcode libraries (BC1–3, Figure S1A) were constructed by inserting a 27bp semi-random barcode sequence based on a previous design,49 along with a 4bp unique library ID sequence, into the 3′ untranslated region of the GFP fluorescence reporter gene of the pLARRY-EGFP vector,18,37 which was a gift from Construct:Article Title: Fitness and transcriptional plasticity of human breast cancer single-cell-derived clones. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pair 2 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGGACTCAC TGGCCGTCGTTTT Integrated DNA technologies N/A Pair 3 forward primer: TCGTCGGCAGCGT CAGATGTGTATAAGAGACAGCAACTAGA AGGCACAGGTCG Integrated DNA technologies N/A Pair 3 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGAGACTCA CTGGCCGTCGTTT Integrated DNA technologies N/A Software and algorithms Metacell version 0.3.7 Baran et al.23 https://tanaylab.github.io/metacell/ Seurat version 5.1.0 Satija et al.27 https://satijalab.org/seurat/ Custom code This paper https://github.com/cclab-brca/ clone-dynamics RStudio version 2023.12.0 + 369 Posit Software, PBC https://posit.co/download/ rstudio-desktop/ FastQC version 0.11.9 Andrews, S.38 N/A Cutadapt version 1.10 Martin, M.39 N/A edgeR version 3.32.1 Chen et al.40 N/A UCell version 2.2 Andreatta and Carmona.41 N/A Pathfinder version 2.3.0.9000 Ulgen et al.42 N/A Mclust version 6.1.1 Scrucca et al.22 N/A DescTools version 0.99.57 Signorell, A.43 N/A lmerTest version 3.1–3 Kuznetsova et al.44 N/A 10x Genomics Cell Ranger version 7.0.1 Zheng et al.45 https://www.10xgenomics.com/ Clustree version 0.5.1 Zappia and Oshlack46 https://github.com/lazappi/clustree scDblFinder version 1.18.0 Germain et al.47 https://github.com/plger/scDblFinder dittoSeq version 1.16.0 Bunis et al.48 https://github.com/dtm2451/dittoSeq 16 Cell Reports 44, 115699, May 27, 2025 .. Barcode library construction and diversity validation Three barcode libraries (BC1–3, Figure S1A) were constructed by inserting a 27bp semi-random barcode sequence based on a previous design,49 along with a 4bp unique library ID sequence, into the 3′ untranslated region of the GFP fluorescence reporter gene of the pLARRY-EGFP vector,18,37 which was a gift from Sequencing:Article Title: Fitness and transcriptional plasticity of human breast cancer single-cell-derived clones. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pair 2 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGGACTCAC TGGCCGTCGTTTT Integrated DNA technologies N/A Pair 3 forward primer: TCGTCGGCAGCGT CAGATGTGTATAAGAGACAGCAACTAGA AGGCACAGGTCG Integrated DNA technologies N/A Pair 3 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGAGACTCA CTGGCCGTCGTTT Integrated DNA technologies N/A Software and algorithms Metacell version 0.3.7 Baran et al.23 https://tanaylab.github.io/metacell/ Seurat version 5.1.0 Satija et al.27 https://satijalab.org/seurat/ Custom code This paper https://github.com/cclab-brca/ clone-dynamics RStudio version 2023.12.0 + 369 Posit Software, PBC https://posit.co/download/ rstudio-desktop/ FastQC version 0.11.9 Andrews, S.38 N/A Cutadapt version 1.10 Martin, M.39 N/A edgeR version 3.32.1 Chen et al.40 N/A UCell version 2.2 Andreatta and Carmona.41 N/A Pathfinder version 2.3.0.9000 Ulgen et al.42 N/A Mclust version 6.1.1 Scrucca et al.22 N/A DescTools version 0.99.57 Signorell, A.43 N/A lmerTest version 3.1–3 Kuznetsova et al.44 N/A 10x Genomics Cell Ranger version 7.0.1 Zheng et al.45 https://www.10xgenomics.com/ Clustree version 0.5.1 Zappia and Oshlack46 https://github.com/lazappi/clustree scDblFinder version 1.18.0 Germain et al.47 https://github.com/plger/scDblFinder dittoSeq version 1.16.0 Bunis et al.48 https://github.com/dtm2451/dittoSeq 16 Cell Reports 44, 115699, May 27, 2025 .. Barcode library construction and diversity validation Three barcode libraries (BC1–3, Figure S1A) were constructed by inserting a 27bp semi-random barcode sequence based on a previous design,49 along with a 4bp unique library ID sequence, into the 3′ untranslated region of the GFP fluorescence reporter gene of the pLARRY-EGFP vector,18,37 which was a gift from Fluorescence:Article Title: Fitness and transcriptional plasticity of human breast cancer single-cell-derived clones. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pair 2 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGGACTCAC TGGCCGTCGTTTT Integrated DNA technologies N/A Pair 3 forward primer: TCGTCGGCAGCGT CAGATGTGTATAAGAGACAGCAACTAGA AGGCACAGGTCG Integrated DNA technologies N/A Pair 3 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGAGACTCA CTGGCCGTCGTTT Integrated DNA technologies N/A Software and algorithms Metacell version 0.3.7 Baran et al.23 https://tanaylab.github.io/metacell/ Seurat version 5.1.0 Satija et al.27 https://satijalab.org/seurat/ Custom code This paper https://github.com/cclab-brca/ clone-dynamics RStudio version 2023.12.0 + 369 Posit Software, PBC https://posit.co/download/ rstudio-desktop/ FastQC version 0.11.9 Andrews, S.38 N/A Cutadapt version 1.10 Martin, M.39 N/A edgeR version 3.32.1 Chen et al.40 N/A UCell version 2.2 Andreatta and Carmona.41 N/A Pathfinder version 2.3.0.9000 Ulgen et al.42 N/A Mclust version 6.1.1 Scrucca et al.22 N/A DescTools version 0.99.57 Signorell, A.43 N/A lmerTest version 3.1–3 Kuznetsova et al.44 N/A 10x Genomics Cell Ranger version 7.0.1 Zheng et al.45 https://www.10xgenomics.com/ Clustree version 0.5.1 Zappia and Oshlack46 https://github.com/lazappi/clustree scDblFinder version 1.18.0 Germain et al.47 https://github.com/plger/scDblFinder dittoSeq version 1.16.0 Bunis et al.48 https://github.com/dtm2451/dittoSeq 16 Cell Reports 44, 115699, May 27, 2025 .. Barcode library construction and diversity validation Three barcode libraries (BC1–3, Figure S1A) were constructed by inserting a 27bp semi-random barcode sequence based on a previous design,49 along with a 4bp unique library ID sequence, into the 3′ untranslated region of the GFP fluorescence reporter gene of the pLARRY-EGFP vector,18,37 which was a gift from Plasmid Preparation:Article Title: Fitness and transcriptional plasticity of human breast cancer single-cell-derived clones. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pair 2 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGGACTCAC TGGCCGTCGTTTT Integrated DNA technologies N/A Pair 3 forward primer: TCGTCGGCAGCGT CAGATGTGTATAAGAGACAGCAACTAGA AGGCACAGGTCG Integrated DNA technologies N/A Pair 3 reverse primer: GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAGAGACTCA CTGGCCGTCGTTT Integrated DNA technologies N/A Software and algorithms Metacell version 0.3.7 Baran et al.23 https://tanaylab.github.io/metacell/ Seurat version 5.1.0 Satija et al.27 https://satijalab.org/seurat/ Custom code This paper https://github.com/cclab-brca/ clone-dynamics RStudio version 2023.12.0 + 369 Posit Software, PBC https://posit.co/download/ rstudio-desktop/ FastQC version 0.11.9 Andrews, S.38 N/A Cutadapt version 1.10 Martin, M.39 N/A edgeR version 3.32.1 Chen et al.40 N/A UCell version 2.2 Andreatta and Carmona.41 N/A Pathfinder version 2.3.0.9000 Ulgen et al.42 N/A Mclust version 6.1.1 Scrucca et al.22 N/A DescTools version 0.99.57 Signorell, A.43 N/A lmerTest version 3.1–3 Kuznetsova et al.44 N/A 10x Genomics Cell Ranger version 7.0.1 Zheng et al.45 https://www.10xgenomics.com/ Clustree version 0.5.1 Zappia and Oshlack46 https://github.com/lazappi/clustree scDblFinder version 1.18.0 Germain et al.47 https://github.com/plger/scDblFinder dittoSeq version 1.16.0 Bunis et al.48 https://github.com/dtm2451/dittoSeq 16 Cell Reports 44, 115699, May 27, 2025 .. Barcode library construction and diversity validation Three barcode libraries (BC1–3, Figure S1A) were constructed by inserting a 27bp semi-random barcode sequence based on a previous design,49 along with a 4bp unique library ID sequence, into the 3′ untranslated region of the GFP fluorescence reporter gene of the pLARRY-EGFP vector,18,37 which was a gift from Article Title: PU.1 inhibition sensitizes stem-monocytic AML to BCL2 blockade Article Snippet: .. Lentiviral barcoding was performed using the pLARRY-EGFP-BCv1 plasmid as previously described . pLARRY-EGFP-BCv1 was a gift from Article Title: Pre-existing stem cell heterogeneity dictates clonal responses to the acquisition of leukemic driver mutations. Article Snippet: .. Plasmid maxipreps were performed using the Endotoxin-Free Plasmid Maxi Kit (Macheray Nagel), following the manufacturer’s protocol. pEB1-T-Sapphire was a gift from Philippe Cluzel (Addgene plasmid 103977). pLARRY-EGFP was a gift from other:Article Title: Leukemia stem cell expansion cultures reveal clonal drivers of leukemogenesis and therapy response Article Snippet: Male C57BL6/J mice (wild-type) and Ptprca (CD45.1) mice were obtained through Charles River Laboratories, France, and conditioned using sub-lethal X-ray irradiation (900 cGy, split dose) in the morning before transplantation in the afternoon of the same day. |